SCer GCAGTCGAACTGACTCTAATAGTGACTCCGGTAAATTAGTTAATTAATTGCTAAACC
SPar GCAGTCGAACTGACTCTAATAGTGACTCCGGTAAATTAGTTAATTAATTGCTAAACC
SMik GCGGTCAAACTGACTCTAATAGTGACTCCGGTAAATTAGTTAATTAATTGCTAAACC
SBay -TGAACGAACTGACTCTAATAGTGACTCTGGTAAATTAGTTAATTAATTTCTAAACC
* ********************* ******************** *******
______**************************************************
A small section of a promoter alignment is shown above, as an example. The aligned promoter sequences for each species -- S. cerevisiae, S. paradoxus, S. mikatae, and S. bayanus -- are on the first 4 lines. The first line of *'s indicates positions in which the same base is shared among all 4 species. The second line of *'s and _'s shows the high conservation and low conservation regions inferred by a hidden Markov model, respectively. Blank positions indicate the location of gaps (one occurs in the 1st character of the sequence).
Acc = Gene Ontology Category Accession ID
Ng = Number of Genes
Zl = z-score for the length of HCR regions in this Gene Ontology category
AveLen = average length of HCR regions in this Gene Ontology category
Term = description
Acc Ng Zl AveLen Term
1 GO0008202 25 +7.142 249.0 steroid metabolism
2 GO0006066 84 +7.070 192.3 alcohol metabolism
3 GO0016126 20 +6.700 253.6 sterol biosynthesis
4 GO0016125 20 +6.700 253.6 sterol metabolism
5 GO0006694 24 +6.635 251.1 steroid biosynthesis
6 GO0008204 18 +6.041 246.4 ergosterol metabolism
7 GO0006696 18 +6.041 246.4 ergosterol biosynthesis
8 GO0006096 12 +5.919 275.8 glycolysis
9 GO0046365 15 +5.823 252.7 monosaccharide catabolism
10 GO0019320 15 +5.823 252.7 hexose catabolism
11 GO0006007 15 +5.823 252.7 glucose catabolism
12 GO0016052 23 +5.608 225.7 carbohydrate catabolism
13 GO0046164 17 +5.357 233.6 alcohol catabolism
14 GO0005975 107 +5.207 165.6 carbohydrate metabolism
15 GO0006006 33 +5.194 200.5 glucose metabolism
16 GO0019318 45 +4.988 187.6 hexose metabolism
17 GO0015980 103 +4.713 163.3 energy derivation by oxidation of organic compounds
18 GO0006091 103 +4.713 163.3 energy pathways
19 GO0016772 191 +4.697 151.3 transferase activity, transferring phosphorus-containing groups
20 GO0016773 121 +4.668 160.6 phosphotransferase activity, alcohol group as acceptor
21 GO0016301 142 +4.654 157.6 kinase activity
22 GO0030312 40 +4.639 188.3 external encapsulating structure
23 GO0009277 40 +4.639 188.3 cell wall (sensu Fungi)
24 GO0005618 40 +4.639 188.3 cell wall
25 GO0006092 39 +4.339 182.6 main pathways of carbohydrate metabolism
26 GO0006629 121 +4.187 156.4 lipid metabolism
27 GO0005996 50 +4.180 177.5 monosaccharide metabolism
28 GO0016564 11 +4.180 237.6 transcriptional repressor activity
29 GO0009653 70 +4.131 166.9 morphogenesis
30 GO0000902 70 +4.131 166.9 cellular morphogenesis
31 GO0019200 11 +4.108 235.9 carbohydrate kinase activity
32 GO0040007 47 +4.012 176.6 growth
33 GO0016538 15 +4.010 211.9 cyclin-dependent protein kinase, intrinsic regulator activity
34 GO0030447 46 +3.980 174.0 filamentous growth
35 GO0007150 46 +3.980 174.0 growth pattern
36 GO0016491 122 +3.977 152.9 oxidoreductase activity
37 GO0004674 60 +3.943 167.4 protein serine/threonine kinase activity
38 GO0016740 395 +3.943 139.2 transferase activity
39 GO0008610 80 +3.930 163.4 lipid biosynthesis
40 GO0000082 30 +3.866 185.7 G1/S transition of mitotic cell cycle
41 GO0019740 10 +3.827 230.3 nitrogen utilization
42 GO0005933 84 +3.805 160.0 bud
43 GO0006807 23 +3.687 189.1 nitrogen metabolism
44 GO0004693 20 +3.615 192.2 cyclin-dependent protein kinase activity
45 GO0004672 95 +3.605 156.2 protein kinase activity
46 GO0030528 188 +3.533 144.8 transcription regulator activity
47 GO0006796 97 +3.530 152.4 phosphate metabolism
48 GO0006793 97 +3.530 152.4 phosphorus metabolism
49 GO0005934 34 +3.372 174.1 bud tip
50 GO0005215 206 +3.362 142.4 transporter activity
51 GO0006869 10 +3.331 216.5 lipid transport
52 GO0005386 58 +3.323 161.0 carrier activity
53 GO0019887 17 +3.248 189.5 protein kinase regulator activity
54 GO0008361 7 +3.223 229.0 regulation of cell size
55 GO0005489 14 +3.202 200.1 electron transporter activity
56 GO0004553 15 +3.125 191.1 hydrolase activity, hydrolyzing O-glycosyl compounds
57 GO0045229 78 +3.098 154.4 external encapsulating structure organization and biogenesis
58 GO0007047 78 +3.098 154.4 cell wall organization and biogenesis
59 GO0000086 19 +3.084 183.4 G2/M transition of mitotic cell cycle
60 GO0030483 86 +2.985 151.2 site of polarized growth (sensu Fungi)
61 GO0030427 86 +2.985 151.2 site of polarized growth
62 GO0000134 86 +2.985 151.2 site of polarized growth (sensu Saccharomyces)
63 GO0016051 39 +2.982 163.7 carbohydrate biosynthesis
64 GO0006355 169 +2.967 141.6 regulation of transcription, DNA-dependent
65 GO0019752 126 +2.960 145.1 carboxylic acid metabolism
66 GO0006082 126 +2.960 145.1 organic acid metabolism
67 GO0007275 205 +2.934 140.8 development
68 GO0007124 29 +2.926 168.9 pseudohyphal growth
69 GO0005976 25 +2.916 173.5 polysaccharide metabolism
70 GO0006357 100 +2.905 147.7 regulation of transcription from Pol II promoter
71 GO0005886 100 +2.905 147.4 plasma membrane
72 GO0045449 175 +2.892 142.0 regulation of transcription
73 GO0009058 477 +2.846 133.9 biosynthesis
74 GO0000079 9 +2.838 208.6 regulation of CDK activity
75 GO0006118 11 +2.818 199.1 electron transport
76 GO0006633 7 +2.807 215.3 fatty acid biosynthesis
77 GO0006094 20 +2.806 176.9 gluconeogenesis
78 GO0003824 1075 +2.798 129.1 catalytic activity
79 GO0046483 42 +2.788 159.1 heterocycle metabolism
80 GO0042626 23 +2.780 173.0 ATPase activity, coupled to transmembrane movement of substances
81 GO0016820 23 +2.780 173.0 hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances
82 GO0015405 23 +2.780 173.0 P-P-bond-hydrolysis-driven transporter activity
83 GO0040020 11 +2.747 197.0 regulation of meiosis
84 GO0003704 28 +2.746 169.4 specific RNA polymerase II transcription factor activity
85 GO0005199 6 +2.732 224.7 structural constituent of cell wall
86 GO0015846 6 +2.705 223.3 polyamine transport
87 GO0016798 20 +2.704 174.3 hydrolase activity, acting on glycosyl bonds
88 GO0006164 28 +2.688 168.4 purine nucleotide biosynthesis
89 GO0015399 31 +2.679 164.2 primary active transporter activity
90 GO0016903 8 +2.673 206.6 oxidoreductase activity, acting on the aldehyde or oxo group of donors
91 GO0016310 76 +2.657 149.1 phosphorylation
92 GO0006113 6 +2.651 221.8 fermentation
93 GO0015926 9 +2.642 202.6 glucosidase activity
94 GO0007154 110 +2.630 144.8 cell communication
95 GO0016879 31 +2.617 163.7 ligase activity, forming carbon-nitrogen bonds
96 GO0009165 31 +2.617 163.5 nucleotide biosynthesis
97 GO0006163 30 +2.609 164.2 purine nucleotide metabolism
98 GO0048066 9 +2.609 201.2 pigmentation
99 GO0046148 9 +2.609 201.2 pigment biosynthesis
100 GO0042440 9 +2.609 201.2 pigment metabolism
101 GO0042168 9 +2.609 201.2 heme metabolism
102 GO0006783 9 +2.609 201.2 heme biosynthesis
103 GO0006779 9 +2.609 201.2 porphyrin biosynthesis
104 GO0006778 9 +2.609 201.2 porphyrin metabolism
105 GO0003700 27 +2.596 167.6 transcription factor activity
106 GO0001403 17 +2.577 175.1 invasive growth (sensu Saccharomyces)
107 GO0007096 6 +2.570 218.2 regulation of exit from mitosis
108 GO0006631 23 +2.567 168.2 fatty acid metabolism
109 GO0016769 8 +2.547 202.2 transferase activity, transferring nitrogenous groups
110 GO0008483 8 +2.547 202.2 transaminase activity
111 GO0046165 22 +2.516 170.2 alcohol biosynthesis
112 GO0015075 61 +2.503 151.1 ion transporter activity
113 GO0006073 18 +2.494 172.5 glucan metabolism
114 GO0030120 20 +2.401 168.6 vesicle coat
115 GO0046364 21 +2.368 168.6 monosaccharide biosynthesis
116 GO0019319 21 +2.368 168.6 hexose biosynthesis
117 GO0030004 14 +2.350 179.6 monovalent inorganic cation homeostasis
118 GO0006112 16 +2.339 175.2 energy reserve metabolism
119 GO0006468 58 +2.302 148.3 protein amino acid phosphorylation
120 GO0000271 13 +2.300 179.8 polysaccharide biosynthesis
121 GO0000122 23 +2.300 163.7 negative regulation of transcription from Pol II promoter
122 GO0006665 18 +2.255 167.6 sphingolipid metabolism
123 GO0007165 100 +2.233 141.6 signal transduction
124 GO0042775 7 +2.211 195.4 ATP synthesis coupled electron transport (sensu Eukarya)
125 GO0042773 7 +2.211 195.4 ATP synthesis coupled electron transport
126 GO0006129 7 +2.211 195.4 protein-disulfide reduction
127 GO0003714 8 +2.202 191.8 transcription co-repressor activity
128 GO0009117 37 +2.189 152.9 nucleotide metabolism
129 GO0008135 32 +2.175 154.1 translation factor activity, nucleic acid binding
130 GO0046394 11 +2.173 181.6 carboxylic acid biosynthesis
131 GO0016053 11 +2.173 181.6 organic acid biosynthesis
132 GO0008324 49 +2.159 149.5 cation transporter activity
133 GO0007242 60 +2.143 147.0 intracellular signaling cascade
134 GO0006414 11 +2.137 180.6 translational elongation
135 GO0008652 57 +2.133 146.7 amino acid biosynthesis
136 GO0019207 24 +2.121 163.1 kinase regulator activity
137 GO0030641 10 +2.094 181.6 hydrogen ion homeostasis
138 GO0006885 10 +2.094 181.6 regulation of pH
139 GO0019222 21 +2.068 162.3 regulation of metabolism
140 GO0009435 6 +2.059 199.2 nicotinamide adenine dinucleotide biosynthesis
141 GO0009309 60 +2.057 145.4 amine biosynthesis
142 GO0009894 7 +2.033 189.6 regulation of catabolism
143 GO0007264 36 +2.029 150.6 small GTPase mediated signal transduction
144 GO0030148 13 +2.026 172.9 sphingolipid biosynthesis
145 GO0045182 38 +2.024 151.6 translation regulator activity
146 GO0015203 9 +2.019 183.7 polyamine transporter activity
147 GO0007088 18 +2.015 162.6 regulation of mitosis
148 GO0000131 18 +2.015 162.5 incipient bud site
149 GO0016638 6 +2.005 197.3 oxidoreductase activity, acting on the CH-NH2 group of donors
150 GO0003746 10 +1.987 178.9 translation elongation factor activity
151 GO0006090 6 +1.978 196.5 pyruvate metabolism
152 GO0006087 6 +1.978 196.5 pyruvate dehydrogenase bypass
153 GO0004871 40 +1.954 149.5 signal transducer activity
154 GO0006099 9 +1.953 181.4 tricarboxylic acid cycle
155 GO0000307 6 +1.951 195.0 cyclin-dependent protein kinase holoenzyme complex
156 GO0016616 30 +1.951 153.2 oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor
157 GO0005941 20 +1.946 159.9 unlocalized
158 GO0005935 62 +1.940 143.7 bud neck
159 GO0006513 12 +1.936 171.5 protein monoubiquitination
160 GO0004009 12 +1.936 171.3 ATP-binding cassette (ABC) transporter activity
161 GO0030117 23 +1.927 156.9 membrane coat
162 GO0042625 11 +1.923 174.7 ATPase activity, coupled to transmembrane movement of ions
163 GO0000209 11 +1.923 174.4 protein polyubiquitination
164 GO0006100 9 +1.920 180.9 TCA intermediate metabolism
165 GO0007015 37 +1.913 148.6 actin filament organization
166 GO0003702 78 +1.866 141.6 RNA polymerase II transcription factor activity
167 GO0009112 20 +1.845 157.0 nucleobase metabolism
168 GO0004872 12 +1.821 168.7 receptor activity
169 GO0016481 64 +1.815 142.3 negative regulation of transcription
170 GO0005937 24 +1.814 157.7 shmoo tip
171 GO0006413 25 +1.804 153.4 translational initiation
172 GO0016651 8 +1.795 178.2 oxidoreductase activity, acting on NADH or NADPH
173 GO0016614 37 +1.775 147.0 oxidoreductase activity, acting on CH-OH group of donors
174 GO0019674 8 +1.763 177.5 nicotinamide adenine dinucleotide metabolism
175 GO0006520 81 +1.763 139.0 amino acid metabolism
176 GO0006519 88 +1.745 137.4 amino acid and derivative metabolism
177 GO0006873 48 +1.738 143.9 cell ion homeostasis
178 GO0016020 468 +1.719 128.3 membrane
179 GO0005746 12 +1.706 165.6 mitochondrial electron transport chain
180 GO0008134 20 +1.693 154.9 transcription factor binding
181 GO0006811 50 +1.691 145.0 ion transport
182 GO0006144 10 +1.669 169.5 purine base metabolism
183 GO0045941 33 +1.656 146.4 positive regulation of transcription
184 GO0042598 7 +1.646 176.1 vesicular fraction
185 GO0005792 7 +1.646 176.1 microsome
186 GO0003743 19 +1.645 154.5 translation initiation factor activity
187 GO0009991 6 +1.627 183.5 response to extracellular stimulus
188 GO0005319 9 +1.593 170.2 lipid transporter activity
189 GO0007568 20 +1.592 152.7 aging
190 GO0008509 12 +1.592 162.7 anion transporter activity
191 GO0005977 12 +1.592 162.2 glycogen metabolism
192 GO0015291 15 +1.577 156.4 porter activity
193 GO0015290 15 +1.577 156.4 electrochemical potential-driven transporter activity
194 GO0030003 41 +1.570 143.8 cation homeostasis
195 GO0019363 7 +1.556 173.0 pyridine nucleotide biosynthesis
196 GO0006820 13 +1.556 160.2 anion transport
197 GO0015078 23 +1.553 149.1 hydrogen ion transporter activity
198 GO0046112 12 +1.553 161.3 nucleobase biosynthesis
199 GO0030036 50 +1.541 142.3 actin cytoskeleton organization and biogenesis
200 GO0015077 25 +1.526 148.2 monovalent inorganic cation transporter activity
201 GO0030234 101 +1.513 134.4 enzyme regulator activity
202 GO0016620 6 +1.493 178.3 oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor
203 GO0045892 63 +1.490 139.9 negative regulation of transcription, DNA-dependent
204 GO0006119 18 +1.488 151.5 oxidative phosphorylation
205 GO0006366 157 +1.461 132.4 transcription from Pol II promoter
206 GO0016567 14 +1.456 157.6 protein ubiquitination
207 GO0004722 21 +1.418 149.2 protein serine/threonine phosphatase activity
208 GO0016765 24 +1.403 149.0 transferase activity, transferring alkyl or aryl (other than methyl) groups
209 GO0042592 54 +1.394 138.7 homeostasis
210 GO0019725 54 +1.394 138.7 cell homeostasis
211 GO0030029 52 +1.385 138.8 actin filament-based process
212 GO0009308 98 +1.373 134.6 amine metabolism
213 GO0016874 58 +1.367 137.0 ligase activity
214 GO0016763 12 +1.362 156.2 transferase activity, transferring pentosyl groups
215 GO0015711 6 +1.358 173.7 organic anion transport
216 GO0007035 6 +1.358 173.8 vacuolar acidification
217 GO0003697 6 +1.358 173.0 single-stranded DNA binding
218 GO0045893 30 +1.352 144.0 positive regulation of transcription, DNA-dependent
219 GO0005829 173 +1.344 130.7 cytosol
220 GO0019856 8 +1.324 163.8 pyrimidine base biosynthesis
221 GO0016265 21 +1.318 147.8 death
222 GO0000074 64 +1.298 136.1 regulation of cell cycle
223 GO0003712 18 +1.296 147.2 transcription cofactor activity
224 GO0019362 22 +1.290 146.6 pyridine nucleotide metabolism
225 GO0006769 22 +1.290 146.6 nicotinamide metabolism
226 GO0005548 7 +1.289 164.0 phospholipid transporter activity
227 GO0030137 13 +1.281 153.5 COPI-coated vesicle
228 GO0016582 57 +1.278 136.7 non-covalent chromatin modification
229 GO0006338 57 +1.278 136.7 chromatin modeling
230 GO0007569 19 +1.248 146.5 cell aging
231 GO0009084 13 +1.242 152.6 glutamine family amino acid biosynthesis
232 GO0000790 22 +1.239 145.9 nuclear chromatin
233 GO0046219 8 +1.230 160.5 indolalkylamine biosynthesis
234 GO0042435 8 +1.230 160.5 indole derivative biosynthesis
235 GO0042434 8 +1.230 160.5 indole derivative metabolism
236 GO0042430 8 +1.230 160.5 indole and derivative metabolism
237 GO0009096 8 +1.230 160.5 aromatic amino acid family biosynthesis, anthranilate pathway
238 GO0006586 8 +1.230 160.5 indolalkylamine metabolism
239 GO0006568 8 +1.230 160.5 tryptophan metabolism
240 GO0000162 8 +1.230 160.5 tryptophan biosynthesis
241 GO0005811 21 +1.218 145.6 lipid particle
242 GO0006725 35 +1.213 139.5 aromatic compound metabolism
243 GO0009082 10 +1.209 156.1 branched chain family amino acid biosynthesis
244 GO0009250 9 +1.167 157.2 glucan biosynthesis
245 GO0019932 13 +1.164 150.6 second-messenger-mediated signaling
246 GO0016563 24 +1.147 144.8 transcriptional activator activity
247 GO0005789 63 +1.146 135.6 endoplasmic reticulum membrane
248 GO0005100 6 +1.143 165.5 Rho GTPase activator activity
249 GO0030468 52 +1.142 135.6 establishment of cell polarity (sensu Fungi)
250 GO0030010 52 +1.142 135.6 establishment of cell polarity
251 GO0000283 52 +1.142 135.6 establishment of cell polarity (sensu Saccharomyces)
252 GO0009081 11 +1.134 152.6 branched chain family amino acid metabolism
253 GO0006512 26 +1.127 141.4 ubiquitin cycle
254 GO0016311 16 +1.121 147.9 dephosphorylation
255 GO0007117 16 +1.077 146.0 bud growth
256 GO0000785 23 +1.073 140.8 chromatin
257 GO0004659 10 +1.068 152.6 prenyltransferase activity
258 GO0005083 33 +1.066 137.2 small GTPase regulatory/interacting protein activity
259 GO0042401 11 +1.063 150.1 biogenic amine biosynthesis
260 GO0004428 6 +1.062 162.7 inositol/phosphatidylinositol kinase activity
261 GO0042398 12 +1.055 148.0 amino acid derivative biosynthesis
262 GO0009266 8 +1.042 154.6 response to temperature
263 GO0005576 9 +1.035 153.4 extracellular
264 GO0008219 20 +1.035 141.7 cell death
265 GO0006914 22 +1.035 141.6 autophagy
266 GO0004842 16 +1.034 145.6 ubiquitin-protein ligase activity
267 GO0004721 32 +1.026 136.7 protein phosphatase activity
268 GO0045944 25 +1.025 139.8 positive regulation of transcription from Pol II promoter
269 GO0019438 13 +1.007 146.4 aromatic compound biosynthesis
270 GO0009073 13 +1.007 146.4 aromatic amino acid family biosynthesis
271 GO0042175 72 +1.007 132.4 nuclear envelope-endoplasmic reticulum network
272 GO0046138 43 +1.006 134.8 coenzymes and prosthetic group biosynthesis
273 GO0042623 55 +1.005 133.8 ATPase activity, coupled
274 GO0006790 30 +0.993 137.9 sulfur metabolism
275 GO0006731 75 +0.993 132.4 coenzymes and prosthetic group metabolism
276 GO0016585 11 +0.991 148.4 chromatin remodeling complex
277 GO0030880 20 +0.985 140.5 RNA polymerase complex
278 GO0019935 8 +0.979 152.1 cyclic-nucleotide-mediated signaling
279 GO0019933 8 +0.979 152.1 cAMP-mediated signaling
280 GO0007093 9 +0.970 151.7 mitotic checkpoint
281 GO0019751 6 +0.954 158.8 polyol metabolism
282 GO0006071 6 +0.954 158.8 glycerol metabolism
283 GO0008320 8 +0.948 151.8 protein carrier activity
284 GO0009260 17 +0.946 141.0 ribonucleotide biosynthesis
285 GO0009152 17 +0.946 141.0 purine ribonucleotide biosynthesis
286 GO0009064 17 +0.946 141.8 glutamine family amino acid metabolism
287 GO0030467 53 +0.946 134.5 establishment and/or maintenance of cell polarity (sensu Fungi)
288 GO0030012 53 +0.946 134.5 establishment and/or maintenance of cell polarity (sensu Saccharomyces)
289 GO0007163 53 +0.946 134.5 establishment and/or maintenance of cell polarity
290 GO0006890 11 +0.919 146.2 retrograde (Golgi to ER) transport
291 GO0003899 21 +0.918 139.1 DNA-directed RNA polymerase activity
292 GO0006575 15 +0.913 141.0 amino acid derivative metabolism
293 GO0006734 6 +0.900 156.7 NADH metabolism
294 GO0006555 14 +0.888 143.9 methionine metabolism
295 GO0006470 14 +0.888 143.9 protein amino acid dephosphorylation
296 GO0006445 14 +0.888 143.7 regulation of translation
297 GO0046486 8 +0.885 149.0 glycerolipid metabolism
298 GO0006662 8 +0.885 149.0 glycerol ether metabolism
299 GO0006641 8 +0.885 149.0 triacylglycerol metabolism
300 GO0006639 8 +0.885 149.0 acylglycerol metabolism
301 GO0006638 8 +0.885 149.0 neutral lipid metabolism
302 GO0005679 8 +0.885 149.2 nucleosome remodeling complex
303 GO0009060 35 +0.879 134.7 aerobic respiration
304 GO0007265 12 +0.864 143.8 RAS protein signal transduction
305 GO0045047 16 +0.859 141.9 protein-ER targeting
306 GO0007266 10 +0.856 146.8 Rho protein signal transduction
307 GO0000137 8 +0.854 148.9 Golgi cis cisterna
308 GO0006576 14 +0.847 142.1 biogenic amine metabolism
309 GO0015662 6 +0.846 154.5 ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism
310 GO0008535 6 +0.846 154.5 cytochrome c oxidase biogenesis
311 GO0006462 6 +0.846 154.5 protein complex assembly, multichaperone pathway
312 GO0016568 92 +0.841 129.3 chromatin modification
313 GO0040029 39 +0.839 133.9 regulation of gene expression, epigenetic
314 GO0006812 36 +0.835 133.6 cation transport
315 GO0016881 22 +0.831 137.4 acid-D-amino acid ligase activity
316 GO0009072 15 +0.825 139.3 aromatic amino acid family metabolism
317 GO0008514 8 +0.823 147.2 organic anion transporter activity
318 GO0008028 8 +0.823 147.2 monocarboxylic acid transporter activity
319 GO0006206 10 +0.785 144.5 pyrimidine base metabolism
320 GO0005774 49 +0.782 131.3 vacuolar membrane
321 GO0005758 15 +0.781 138.7 mitochondrial intermembrane space
322 GO0007231 9 +0.773 145.1 osmosensory signaling pathway
323 GO0005940 9 +0.773 145.7 septin ring
324 GO0003677 107 +0.766 127.7 DNA binding
325 GO0030127 6 +0.765 151.0 COPII vesicle coat
326 GO0016627 8 +0.760 145.9 oxidoreductase activity, acting on the CH-CH group of donors
327 GO0007029 17 +0.755 137.4 ER organization and biogenesis
328 GO0006733 30 +0.754 133.2 oxidoreduction coenzyme metabolism
329 GO0005275 23 +0.753 134.2 amine/polyamine transporter activity
330 GO0006791 7 +0.753 146.7 sulfur utilization
331 GO0000103 7 +0.753 146.7 sulfate assimilation
332 GO0000075 19 +0.751 136.7 cell cycle checkpoint
333 GO0000183 10 +0.749 143.7 chromatin silencing at ribosomal DNA (rDNA)
334 GO0019866 84 +0.737 128.2 inner membrane
335 GO0005743 84 +0.737 128.2 mitochondrial inner membrane
336 GO0015992 13 +0.733 139.3 proton transport
337 GO0015672 13 +0.733 139.3 monovalent inorganic cation transport
338 GO0006818 13 +0.733 139.3 hydrogen transport
339 GO0006348 20 +0.732 135.4 chromatin silencing at telomere
340 GO0019205 6 +0.711 149.3 nucleobase, nucleoside, nucleotide kinase activity
341 GO0005887 12 +0.711 139.0 integral to plasma membrane
342 GO0004407 12 +0.711 139.9 histone deacetylase activity
343 GO0009076 9 +0.708 143.7 histidine family amino acid biosynthesis
344 GO0009075 9 +0.708 143.7 histidine family amino acid metabolism
345 GO0006547 9 +0.708 143.7 histidine metabolism
346 GO0000105 9 +0.708 143.7 histidine biosynthesis
347 GO0005783 217 +0.702 125.4 endoplasmic reticulum
348 GO0007582 2387 +0.701 123.4 physiological processes
349 GO0009066 23 +0.700 133.7 aspartate family amino acid metabolism
350 GO0030125 8 +0.697 143.2 clathrin vesicle coat
351 GO0030118 8 +0.697 143.2 clathrin coat
352 GO0045333 36 +0.695 131.0 cellular respiration
353 GO0042546 6 +0.685 148.8 cell wall biosynthesis
354 GO0009272 6 +0.685 148.8 cell wall biosynthesis (sensu Fungi)
355 GO0007120 10 +0.679 141.5 axial budding
356 GO0006970 34 +0.676 131.4 response to osmotic stress
357 GO0009259 18 +0.673 134.7 ribonucleotide metabolism
358 GO0009150 18 +0.673 134.7 purine ribonucleotide metabolism
359 GO0000151 17 +0.659 135.2 ubiquitin ligase complex
360 GO0009127 6 +0.658 147.0 purine nucleoside monophosphate biosynthesis
361 GO0009124 6 +0.658 147.0 nucleoside monophosphate biosynthesis
362 GO0006875 28 +0.654 133.1 metal ion homeostasis
363 GO0019867 15 +0.648 135.2 outer membrane
364 GO0005741 15 +0.648 135.2 mitochondrial outer membrane
365 GO0006950 209 +0.647 125.2 response to stress
366 GO0006350 372 +0.646 124.4 transcription
367 GO0009067 10 +0.643 140.9 aspartate family amino acid biosynthesis
368 GO0006613 10 +0.643 140.8 cotranslational membrane targeting
369 GO0016747 43 +0.640 129.2 transferase activity, transferring groups other than amino-acyl groups
370 GO0001301 6 +0.631 146.2 progressive alteration of chromatin during cell aging
371 GO0015698 9 +0.609 140.0 inorganic anion transport
372 GO0046527 7 +0.604 141.9 glucosyltransferase activity
373 GO0009415 8 +0.603 140.2 response to water
374 GO0009414 8 +0.603 140.2 response to water deprivation
375 GO0009269 8 +0.603 140.2 response to dessication
376 GO0000096 19 +0.602 133.6 sulfur amino acid metabolism
377 GO0006325 102 +0.596 126.8 establishment and/or maintenance of chromatin architecture
378 GO0006323 102 +0.596 126.8 DNA packaging
379 GO0007243 12 +0.596 136.2 protein kinase cascade
380 GO0003925 20 +0.580 132.8 small monomeric GTPase activity
381 GO0016830 13 +0.576 135.5 carbon-carbon lyase activity
382 GO0009892 7 +0.574 140.0 negative regulation of metabolism
383 GO0005740 105 +0.572 126.7 mitochondrial membrane
384 GO0007166 21 +0.567 132.1 cell surface receptor linked signal transduction
385 GO0019898 15 +0.560 133.5 extrinsic to membrane
386 GO0016836 16 +0.555 134.8 hydro-lyase activity
387 GO0006767 36 +0.554 129.5 water-soluble vitamin metabolism
388 GO0006766 36 +0.554 129.5 vitamin metabolism
389 GO0005773 100 +0.554 126.2 vacuole
390 GO0016575 8 +0.540 138.5 histone deacetylation
391 GO0006353 8 +0.540 138.4 transcription termination
392 GO0006303 10 +0.537 137.1 double-strand break repair via nonhomologous end-joining
393 GO0008565 25 +0.525 130.2 protein transporter activity
394 GO0015837 26 +0.524 131.0 amine/polyamine transport
395 GO0009206 12 +0.519 134.8 purine ribonucleoside triphosphate biosynthesis
396 GO0009205 12 +0.519 134.8 purine ribonucleoside triphosphate metabolism
397 GO0009201 12 +0.519 134.8 ribonucleoside triphosphate biosynthesis
398 GO0009199 12 +0.519 134.8 ribonucleoside triphosphate metabolism
399 GO0009145 12 +0.519 134.8 purine nucleoside triphosphate biosynthesis
400 GO0009144 12 +0.519 134.8 purine nucleoside triphosphate metabolism
401 GO0009142 12 +0.519 134.8 nucleoside triphosphate biosynthesis
402 GO0000910 40 +0.509 128.1 cytokinesis
403 GO0004536 11 +0.489 134.8 deoxyribonuclease activity
404 GO0006616 7 +0.485 137.7 SRP-dependent cotranslational membrane targeting, translocation
405 GO0007001 114 +0.475 125.2 chromosome organization and biogenesis (sensu Eukarya)
406 GO0030466 13 +0.458 132.2 chromatin silencing at silent mating-type cassettes (sensu Fungi)
407 GO0006347 13 +0.458 132.2 chromatin silencing at HML and HMR (sensu Saccharomyces)
408 GO0045263 8 +0.446 135.1 proton-transporting ATP synthase complex, coupling factor F(o)
409 GO0000276 8 +0.446 135.1 proton-transporting ATP synthase complex, coupling factor F(o) (sensu Eukarya)
410 GO0004840 9 +0.446 135.6 ubiquitin conjugating enzyme activity
411 GO0030473 6 +0.442 139.7 nuclear migration (sensu Fungi)
412 GO0000065 6 +0.442 139.7 nuclear migration (sensu Saccharomyces)
413 GO0000165 10 +0.431 134.4 MAPKKK cascade
414 GO0016757 60 +0.428 126.7 transferase activity, transferring glycosyl groups
415 GO0007234 7 +0.425 135.0 osmosensory signaling pathway via two-component system
416 GO0000160 7 +0.425 135.0 two-component signal transduction system (phosphorelay)
417 GO0046873 17 +0.419 130.3 metal ion transporter activity
418 GO0045277 6 +0.415 138.2 respiratory chain complex IV
419 GO0016676 6 +0.415 138.2 oxidoreductase activity, acting on heme group of donors, oxygen as acceptor
420 GO0016675 6 +0.415 138.2 oxidoreductase activity, acting on heme group of donors
421 GO0015002 6 +0.415 138.2 heme-copper terminal oxidase activity
422 GO0005751 6 +0.415 138.2 respiratory chain complex IV (sensu Eukarya)
423 GO0004129 6 +0.415 138.2 cytochrome-c oxidase activity
424 GO0006997 141 +0.410 124.2 nuclear organization and biogenesis
425 GO0016023 56 +0.397 126.5 cytoplasmic vesicle
426 GO0030864 37 +0.395 126.2 cortical actin cytoskeleton
427 GO0030863 37 +0.395 126.2 cortical cytoskeleton
428 GO0009607 30 +0.395 127.6 response to biotic stimulus
429 GO0009141 13 +0.380 130.8 nucleoside triphosphate metabolism
430 GO0006109 13 +0.380 130.8 regulation of carbohydrate metabolism
431 GO0030479 21 +0.367 128.6 actin cortical patch (sensu Fungi)
432 GO0005857 21 +0.367 128.6 actin cortical patch (sensu Saccharomyces)
433 GO0003924 34 +0.363 126.4 GTPase activity
434 GO0008374 6 +0.361 136.2 O-acyltransferase activity
435 GO0008639 10 +0.360 132.7 small protein conjugating enzyme activity
436 GO0005795 10 +0.360 132.3 Golgi stack
437 GO0009987 1339 +0.352 122.4 cellular process
438 GO0008152 1726 +0.352 122.1 metabolism
439 GO0008151 1286 +0.352 122.4 cell growth and/or maintenance
440 GO0019954 47 +0.345 126.8 asexual reproduction
441 GO0007114 47 +0.345 126.8 budding
442 GO0042578 55 +0.341 126.0 phosphoric ester hydrolase activity
443 GO0006057 7 +0.336 132.1 mannoprotein biosynthesis
444 GO0006056 7 +0.336 132.1 mannoprotein metabolism
445 GO0000032 7 +0.336 132.1 cell wall mannoprotein biosynthesis
446 GO0016746 52 +0.330 125.2 transferase activity, transferring acyl groups
447 GO0016485 12 +0.328 129.0 protein processing
448 GO0045814 37 +0.326 125.3 negative regulation of gene expression, epigenetic
449 GO0006342 37 +0.326 125.3 chromatin silencing
450 GO0003773 10 +0.325 131.6 heat shock protein activity
451 GO0015082 17 +0.323 128.5 di-, tri-valent inorganic cation transporter activity
452 GO0009167 6 +0.307 134.3 purine ribonucleoside monophosphate metabolism
453 GO0009161 6 +0.307 134.3 ribonucleoside monophosphate metabolism
454 GO0005938 62 +0.305 124.8 cell cortex
455 GO0016021 112 +0.302 124.5 integral to membrane
456 GO0016791 51 +0.297 125.5 phosphoric monoester hydrolase activity
457 GO0046916 20 +0.276 126.7 transition metal ion homeostasis
458 GO0042364 17 +0.275 127.2 water-soluble vitamin biosynthesis
459 GO0009110 17 +0.275 127.2 vitamin biosynthesis
460 GO0005096 24 +0.275 127.9 GTPase activator activity
461 GO0000288 13 +0.262 127.5 mRNA catabolism, deadenylation-dependent
462 GO0009126 7 +0.247 129.9 purine nucleoside monophosphate metabolism
463 GO0009123 7 +0.247 129.9 nucleoside monophosphate metabolism
464 GO0005342 27 +0.234 125.0 organic acid transporter activity
465 GO0030695 40 +0.233 124.0 GTPase regulator activity
466 GO0006614 8 +0.227 128.9 SRP-dependent cotranslational membrane targeting
467 GO0016835 20 +0.226 125.0 carbon-oxygen lyase activity
468 GO0006351 349 +0.225 122.8 transcription, DNA-dependent
469 GO0030005 24 +0.224 126.2 di-, tri-valent inorganic cation homeostasis
470 GO0030363 10 +0.219 128.6 pre-mRNA cleavage factor activity
471 GO0009069 10 +0.219 128.9 serine family amino acid metabolism
472 GO0007155 7 +0.217 128.0 cell adhesion
473 GO0000278 188 +0.215 122.4 mitotic cell cycle
474 GO0000118 16 +0.207 126.8 histone deacetylase complex
475 GO0006476 11 +0.203 126.3 protein amino acid deacetylation
476 GO0016780 6 +0.200 130.0 phosphotransferase activity, for other substituted phosphate groups
477 GO0046943 25 +0.191 124.9 carboxylic acid transporter activity
478 GO0030150 13 +0.184 125.2 mitochondrial matrix protein import
479 GO0042273 10 +0.184 127.3 ribosomal large subunit biogenesis
480 GO0003928 6 +0.173 129.3 RAB small monomeric GTPase activity
481 GO0006643 60 +0.171 123.4 membrane lipid metabolism
482 GO0007094 8 +0.164 126.8 mitotic spindle checkpoint
483 GO0006732 66 +0.162 123.1 coenzyme metabolism
484 GO0019897 7 +0.157 126.4 extrinsic to plasma membrane
485 GO0016829 44 +0.157 123.6 lyase activity
486 GO0008047 44 +0.157 123.8 enzyme activator activity
487 GO0006493 9 +0.151 126.9 O-linked glycosylation
488 GO0006369 7 +0.128 125.0 transcription termination from Pol II promoter
489 GO0030135 47 +0.125 123.6 coated vesicle
490 GO0030015 6 +0.119 127.2 CCR4-NOT core complex
491 GO0000289 6 +0.119 127.2 poly(A) tail shortening
492 GO0009889 10 +0.113 125.4 regulation of biosynthesis
493 GO0007105 10 +0.113 125.8 cytokinesis, site selection
494 GO0000282 10 +0.113 125.8 bud site selection
495 GO0030138 13 +0.106 123.3 COPII-coated vesicle
496 GO0006879 13 +0.106 123.5 iron ion homeostasis
497 GO0008415 42 +0.104 122.6 acyltransferase activity
498 GO0007531 8 +0.101 124.5 mating-type determination
499 GO0007530 8 +0.101 124.5 sex determination
500 GO0007097 8 +0.101 124.9 nuclear migration
501 GO0046034 11 +0.095 123.5 ATP metabolism
502 GO0045259 11 +0.095 123.5 proton-transporting ATP synthase complex
503 GO0045255 11 +0.095 123.5 hydrogen-translocating F-type ATPase complex
504 GO0016469 11 +0.095 123.5 proton-transporting two-sector ATPase complex
505 GO0015986 11 +0.095 123.5 ATP synthesis coupled proton transport
506 GO0015985 11 +0.095 123.5 energy coupled proton transport, down the electrochemical gradient
507 GO0006754 11 +0.095 123.5 ATP biosynthesis
508 GO0006753 11 +0.095 123.5 nucleoside phosphate metabolism
509 GO0005753 11 +0.095 123.5 proton-transporting ATP synthase complex (sensu Eukarya)
510 GO0016282 25 +0.080 122.5 eukaryotic 43S preinitiation complex
511 GO0030478 16 +0.076 123.0 actin cap (sensu Fungi)
512 GO0000143 16 +0.076 123.0 actin cap (sensu Saccharomyces)
513 GO0045896 8 +0.070 123.4 regulation of transcription, mitotic
514 GO0007068 8 +0.070 123.4 negative regulation of transcription, mitotic
515 GO0005849 6 +0.065 125.8 mRNA cleavage factor complex
516 GO0006612 12 +0.060 122.1 protein-membrane targeting
517 GO0005625 18 +0.049 121.6 soluble fraction
518 GO0006111 7 +0.038 122.4 regulation of gluconeogenesis
519 GO0045912 6 +0.038 124.5 negative regulation of carbohydrate metabolism
520 GO0045721 6 +0.038 124.5 negative regulation of gluconeogenesis
521 GO0009890 6 +0.038 124.5 negative regulation of biosynthesis
522 GO0009056 182 +0.021 121.8 catabolism
523 GO0046942 24 +0.018 122.8 carboxylic acid transport
524 GO0015849 24 +0.018 122.8 organic acid transport
525 GO0009605 133 +0.010 121.1 response to external stimulus
526 GO0005737 1896 +0.003 121.4 cytoplasm
527 GO0005623 2869 +0.003 121.5 cell
528 GO0003674 3253 +0.003 121.0 molecular_function
529 GO0019213 14 -0.006 121.0 deacetylase activity
530 GO0046933 9 -0.013 121.2 hydrogen-transporting ATP synthase activity, rotational mechanism
531 GO0016779 48 -0.014 121.1 nucleotidyltransferase activity
532 GO0006378 15 -0.015 120.1 mRNA polyadenylation
533 GO0006388 6 -0.016 122.5 tRNA splicing
534 GO0000394 6 -0.016 122.5 RNA splicing, via endonucleolytic cleavage and ligation
535 GO0000139 12 -0.017 120.9 Golgi membrane
536 GO0030866 8 -0.024 120.5 cortical actin cytoskeleton organization and biogenesis
537 GO0030865 8 -0.024 120.5 cortical cytoskeleton organization and biogenesis
538 GO0000147 8 -0.024 120.5 actin cortical patch assembly
539 GO0000030 26 -0.024 120.6 mannosyltransferase activity
540 GO0006800 25 -0.031 120.4 oxygen and reactive oxygen species metabolism
541 GO0016458 41 -0.040 121.4 gene silencing
542 GO0016440 41 -0.040 121.4 transcriptional gene silencing
543 GO0006740 6 -0.043 121.8 NADPH regeneration
544 GO0000726 19 -0.043 120.2 non-recombinational repair
545 GO0016579 12 -0.055 119.4 protein deubiquitination
546 GO0005736 12 -0.055 119.8 DNA-directed RNA polymerase I complex
547 GO0001302 12 -0.055 119.5 replicative cell aging
548 GO0008643 7 -0.081 118.4 carbohydrate transport
549 GO0006379 11 -0.084 118.5 mRNA cleavage
550 GO0018193 7 -0.110 117.4 peptidyl-amino acid modification
551 GO0009628 105 -0.118 120.8 response to abiotic stimulus
552 GO0006464 243 -0.136 120.3 protein modification
553 GO0000324 75 -0.142 120.5 vacuole (sensu Fungi)
554 GO0000323 75 -0.142 120.5 lytic vacuole
555 GO0000322 75 -0.142 120.5 storage vacuole
556 GO0030119 8 -0.149 116.9 membrane coat adaptor complex
557 GO0007118 8 -0.149 116.6 apical bud growth
558 GO0030014 11 -0.156 116.8 CCR4-NOT complex
559 GO0007186 13 -0.169 116.0 G-protein coupled receptor protein signaling pathway
560 GO0016758 48 -0.173 119.4 transferase activity, transferring hexosyl groups
561 GO0030364 9 -0.177 116.9 cleavage/polyadenylation specificity factor activity
562 GO0006525 9 -0.177 116.7 arginine metabolism
563 GO0000051 9 -0.177 116.7 urea cycle intermediate metabolism
564 GO0015674 20 -0.179 117.0 di-, tri-valent inorganic cation transport
565 GO0046467 46 -0.181 119.8 membrane lipid biosynthesis
566 GO0008289 11 -0.191 115.2 lipid binding
567 GO0009108 34 -0.201 117.2 coenzyme biosynthesis
568 GO0004520 10 -0.206 116.9 endodeoxyribonuclease activity
569 GO0005666 9 -0.210 115.8 DNA-directed RNA polymerase III complex
570 GO0016866 8 -0.212 114.9 intramolecular transferase activity
571 GO0016831 7 -0.230 113.3 carboxy-lyase activity
572 GO0016887 89 -0.231 119.3 ATPase activity
573 GO0004620 6 -0.231 114.7 phospholipase activity
574 GO0016818 137 -0.239 119.8 hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides
575 GO0016817 137 -0.239 119.8 hydrolase activity, acting on acid anhydrides
576 GO0005665 10 -0.241 115.0 DNA-directed RNA polymerase II, core complex
577 GO0000267 53 -0.242 119.5 cell fraction
578 GO0006810 444 -0.252 120.9 transport
579 GO0006897 27 -0.273 116.3 endocytosis
580 GO0000243 8 -0.275 112.2 commitment complex
581 GO0001510 10 -0.276 114.4 RNA methylation
582 GO0008033 17 -0.300 115.7 tRNA processing
583 GO0007010 155 -0.316 119.7 cytoskeleton organization and biogenesis
584 GO0000003 94 -0.331 118.5 reproduction
585 GO0015144 8 -0.338 110.6 carbohydrate transporter activity
586 GO0003777 6 -0.339 110.0 microtubule motor activity
587 GO0005732 19 -0.341 114.3 small nucleolar ribonucleoprotein complex
588 GO0008150 3254 -0.347 121.0 biological_process
589 GO0005575 3254 -0.347 121.0 cellular_component
590 GO0003673 3254 -0.347 121.0 Gene_Ontology
591 GO0015171 17 -0.348 114.4 amino acid transporter activity
592 GO0005624 36 -0.359 116.2 membrane fraction
593 GO0008094 12 -0.362 111.3 DNA dependent ATPase activity
594 GO0004843 12 -0.362 111.3 ubiquitin-specific protease activity
595 GO0016645 8 -0.369 109.5 oxidoreductase activity, acting on the CH-NH group of donors
596 GO0008213 8 -0.369 109.8 protein amino acid alkylation
597 GO0006479 8 -0.369 109.8 protein amino acid methylation
598 GO0016646 7 -0.378 108.3 oxidoreductase activity, acting on the CH-NH group of donors, NAD or NADP as acceptor
599 GO0006606 32 -0.379 114.8 protein-nucleus import
600 GO0003779 10 -0.382 111.7 actin binding
601 GO0006457 28 -0.392 115.7 protein folding
602 GO0000742 6 -0.393 108.3 karyogamy during conjugation with cellular fusion
603 GO0016283 22 -0.394 114.0 eukaryotic 48S initiation complex
604 GO0005843 22 -0.394 114.0 cytosolic small ribosomal subunit (sensu Eukarya)
605 GO0005685 8 -0.400 108.0 snRNP U1
606 GO0000750 9 -0.407 109.4 signal transduction during conjugation with cellular fusion
607 GO0006650 26 -0.408 113.8 glycerophospholipid metabolism
608 GO0045003 7 -0.408 107.3 double-strand break repair via synthesis-dependent strand annealing
609 GO0005770 7 -0.408 107.9 late endosome
610 GO0004003 7 -0.408 107.9 ATP dependent DNA helicase activity
611 GO0030474 6 -0.420 107.0 spindle pole body duplication (sensu Fungi)
612 GO0015071 6 -0.420 107.5 protein phosphatase type 2C activity
613 GO0007103 6 -0.420 107.0 spindle pole body duplication (sensu Saccharomyces)
614 GO0006301 6 -0.420 107.0 postreplication repair
615 GO0006383 20 -0.432 113.0 transcription from Pol III promoter
616 GO0030001 21 -0.433 112.3 metal ion transport
617 GO0016573 21 -0.433 112.6 histone acetylation
618 GO0006739 7 -0.438 106.7 NADPH metabolism
619 GO0046915 11 -0.442 108.5 transition metal ion transporter activity
620 GO0004857 11 -0.442 108.5 enzyme inhibitor activity
621 GO0006893 13 -0.443 109.1 Golgi to plasma membrane transport
622 GO0008234 17 -0.444 112.0 cysteine-type peptidase activity
623 GO0006944 22 -0.446 112.3 membrane fusion
624 GO0007126 67 -0.447 116.4 meiosis
625 GO0015149 6 -0.447 106.3 hexose transporter activity
626 GO0015145 6 -0.447 106.3 monosaccharide transporter activity
627 GO0005759 84 -0.451 116.2 mitochondrial matrix
628 GO0016814 11 -0.478 107.9 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines
629 GO0000152 11 -0.478 107.4 nuclear ubiquitin ligase complex
630 GO0000041 14 -0.493 109.8 transition metal ion transport
631 GO0005515 150 -0.495 118.0 protein binding
632 GO0006979 22 -0.497 111.4 response to oxidative stress
633 GO0006526 7 -0.497 104.7 arginine biosynthesis
634 GO0003676 272 -0.501 118.7 nucleic acid binding
635 GO0005667 86 -0.524 116.9 transcription factor complex
636 GO0005057 8 -0.526 104.9 receptor signaling protein activity
637 GO0006409 18 -0.526 109.4 tRNA-nucleus export
638 GO0004702 6 -0.528 103.2 receptor signaling protein serine/threonine kinase activity
639 GO0006302 24 -0.546 111.1 double-strand break repair
640 GO0000109 12 -0.553 106.2 nucleotide excision repair complex
641 GO0016407 27 -0.554 111.6 acetyltransferase activity
642 GO0007534 7 -0.557 102.1 gene conversion at MAT locus
643 GO0007533 7 -0.557 102.1 mating-type switching/recombination
644 GO0003684 7 -0.557 102.3 damaged DNA binding
645 GO0016043 721 -0.574 119.6 cell organization and biogenesis
646 GO0030481 6 -0.582 101.7 septin ring (sensu Fungi)
647 GO0000144 6 -0.582 101.7 septin ring (sensu Saccharomyces)
648 GO0005085 11 -0.586 104.5 guanyl-nucleotide exchange factor activity
649 GO0019843 7 -0.587 101.0 rRNA binding
650 GO0000741 8 -0.588 102.5 karyogamy
651 GO0000740 8 -0.588 102.5 nuclear membrane fusion
652 GO0007062 15 -0.590 107.5 sister chromatid cohesion
653 GO0009101 45 -0.598 113.7 glycoprotein biosynthesis
654 GO0006486 45 -0.598 113.7 protein amino acid glycosylation
655 GO0006267 7 -0.616 100.6 pre-replicative complex formation and maintenance
656 GO0005847 10 -0.630 104.0 mRNA cleavage and polyadenylation specificity factor complex
657 GO0000154 10 -0.630 104.5 rRNA modification
658 GO0016570 38 -0.633 112.6 histone modification
659 GO0016569 38 -0.633 112.6 covalent chromatin modification
660 GO0030261 20 -0.634 108.0 chromosome condensation
661 GO0000136 6 -0.662 98.3 mannosyltransferase complex
662 GO0045002 9 -0.669 101.3 double-strand break repair via single-strand annealing
663 GO0015629 64 -0.683 113.2 actin cytoskeleton
664 GO0000070 20 -0.685 107.3 mitotic chromosome segregation
665 GO0045454 6 -0.689 97.3 cell redox homeostasis
666 GO0030503 6 -0.689 97.3 regulation of redox homeostasis
667 GO0005730 122 -0.694 116.0 nucleolus
668 GO0005622 2654 -0.696 119.7 intracellular
669 GO0006487 32 -0.698 109.9 N-linked glycosylation
670 GO0006626 24 -0.700 108.7 protein-mitochondrial targeting
671 GO0005782 10 -0.701 102.7 peroxisomal matrix
672 GO0000054 10 -0.701 102.2 ribosome-nucleus export
673 GO0042144 9 -0.702 100.6 vacuole fusion (non-autophagic)
674 GO0019953 51 -0.704 112.1 sexual reproduction
675 GO0000747 51 -0.704 112.1 conjugation with cellular fusion
676 GO0000746 51 -0.704 112.1 conjugation
677 GO0005840 116 -0.710 115.2 ribosome
678 GO0007119 6 -0.716 96.8 isotropic bud growth
679 GO0006730 6 -0.716 96.8 one-carbon compound metabolism
680 GO0006865 18 -0.717 105.8 amino acid transport
681 GO0006610 18 -0.717 105.3 ribosomal protein-nucleus import
682 GO0006608 18 -0.717 105.3 snRNP protein-nucleus import
683 GO0006607 18 -0.717 105.3 NLS-bearing substrate-nucleus import
684 GO0006408 18 -0.717 105.3 snRNA-nucleus export
685 GO0000301 9 -0.734 99.4 retrograde (vesicle recycling within Golgi) transport
686 GO0016846 7 -0.736 96.7 carbon-sulfur lyase activity
687 GO0006743 7 -0.736 96.3 ubiquinone metabolism
688 GO0030433 10 -0.736 101.8 ER-associated protein catabolism
689 GO0006473 26 -0.737 107.8 protein amino acid acetylation
690 GO0000027 23 -0.741 106.6 ribosomal large subunit assembly and maintenance
691 GO0009063 6 -0.743 95.3 amino acid catabolism
692 GO0005543 8 -0.745 97.1 phospholipid binding
693 GO0007121 22 -0.752 106.0 polar budding
694 GO0000723 13 -0.757 101.4 telomere maintenance
695 GO0006268 7 -0.765 95.9 DNA unwinding
696 GO0004725 7 -0.765 95.4 protein tyrosine phosphatase activity
697 GO0015268 6 -0.770 94.7 alpha-type channel activity
698 GO0015267 6 -0.770 94.7 channel/pore class transporter activity
699 GO0007030 6 -0.770 94.5 Golgi organization and biogenesis
700 GO0030480 17 -0.779 105.7 contractile ring (sensu Fungi)
701 GO0005826 17 -0.779 105.7 contractile ring
702 GO0000142 17 -0.779 105.7 contractile ring (sensu Saccharomyces)
703 GO0016072 12 -0.783 100.7 rRNA metabolism
704 GO0009100 46 -0.797 111.8 glycoprotein metabolism
705 GO0000784 11 -0.800 98.9 nuclear chromosome, telomeric region
706 GO0000781 11 -0.800 98.9 chromosome, telomeric region
707 GO0003767 10 -0.807 99.0 co-chaperone activity
708 GO0005830 48 -0.810 111.1 cytosolic ribosome (sensu Eukarya)
709 GO0004402 12 -0.821 99.8 histone acetyltransferase activity
710 GO0030677 6 -0.824 92.0 ribonuclease P complex
711 GO0006269 6 -0.824 92.2 DNA replication, priming
712 GO0005655 6 -0.824 92.0 nucleolar ribonuclease P complex
713 GO0004526 6 -0.824 92.0 ribonuclease P activity
714 GO0006270 17 -0.827 104.7 DNA replication initiation
715 GO0005842 21 -0.833 104.9 cytosolic large ribosomal subunit (sensu Eukarya)
716 GO0030176 13 -0.835 99.4 integral to endoplasmic reticulum membrane
717 GO0000245 11 -0.836 97.5 spliceosome assembly
718 GO0005885 6 -0.851 91.8 Arp2/3 protein complex
719 GO0000124 14 -0.858 100.6 SAGA complex
720 GO0016891 12 -0.860 98.4 endoribonuclease activity, producing 5'-phosphomonoesters
721 GO0030488 9 -0.866 95.8 tRNA methylation
722 GO0008238 11 -0.872 96.9 exopeptidase activity
723 GO0016810 39 -0.875 109.7 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds
724 GO0019774 6 -0.878 90.3 proteasome core complex, beta-subunit complex (sensu Eukarya)
725 GO0005658 6 -0.878 90.5 alpha DNA polymerase:primase complex
726 GO0000087 78 -0.882 112.0 M phase of mitotic cell cycle
727 GO0003887 16 -0.882 101.2 DNA-directed DNA polymerase activity
728 GO0004386 48 -0.890 110.4 helicase activity
729 GO0000123 32 -0.890 106.5 histone acetyltransferase complex
730 GO0000084 68 -0.890 111.4 S phase of mitotic cell cycle
731 GO0005816 34 -0.891 106.4 spindle pole body
732 GO0005815 34 -0.891 106.4 microtubule organizing center
733 GO0012505 128 -0.893 114.9 endomembrane system
734 GO0003724 29 -0.898 106.8 RNA helicase activity
735 GO0006333 12 -0.898 97.8 chromatin assembly/disassembly
736 GO0005488 462 -0.899 117.4 binding
737 GO0016811 23 -0.901 103.9 hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in linear amides
738 GO0016071 49 -0.901 109.2 mRNA metabolism
739 GO0003682 13 -0.913 97.9 chromatin binding
740 GO0000922 37 -0.916 107.7 spindle pole
741 GO0006260 67 -0.921 111.3 DNA replication
742 GO0042221 25 -0.921 104.4 response to chemical substance
743 GO0008186 19 -0.937 102.0 RNA dependent ATPase activity
744 GO0006289 19 -0.937 102.8 nucleotide-excision repair
745 GO0004004 19 -0.937 102.0 ATP dependent RNA helicase activity
746 GO0000749 20 -0.938 102.8 response to pheromone during conjugation with cellular fusion
747 GO0006515 11 -0.944 94.8 misfolded or incompletely synthesized protein catabolism
748 GO0000172 7 -0.944 89.0 ribonuclease MRP complex
749 GO0000171 7 -0.944 89.0 ribonuclease MRP activity
750 GO0042277 10 -0.948 95.9 peptide binding
751 GO0016860 10 -0.948 95.9 intramolecular isomerase activity
752 GO0005048 10 -0.948 95.9 signal sequence binding
753 GO0006418 18 -0.957 100.1 amino acid activation
754 GO0042054 6 -0.959 87.5 histone methyltransferase activity
755 GO0018024 6 -0.959 87.5 histone-lysine N-methyltransferase activity
756 GO0016571 6 -0.959 87.5 histone methylation
757 GO0000727 6 -0.959 87.8 double-strand break repair via break-induced replication
758 GO0046021 7 -0.974 88.3 regulation of transcription from Pol II promoter, mitotic
759 GO0007070 7 -0.974 88.3 negative regulation of transcription from Pol II promoter, mitotic
760 GO0005675 7 -0.974 88.3 transcription factor TFIIH complex
761 GO0015935 42 -0.985 107.4 small ribosomal subunit
762 GO0006365 37 -0.985 106.9 35S primary transcript processing
763 GO0006999 20 -0.988 101.2 nuclear pore organization and biogenesis
764 GO0005663 8 -0.996 89.2 DNA replication factor C complex
765 GO0008283 361 -1.002 116.9 cell proliferation
766 GO0004549 7 -1.003 87.1 tRNA-specific ribonuclease activity
767 GO0008026 27 -1.004 103.7 ATP dependent helicase activity
768 GO0007034 24 -1.007 102.4 vacuolar transport
769 GO0003774 11 -1.015 92.3 motor activity
770 GO0005874 17 -1.019 100.5 microtubule
771 GO0005844 8 -1.027 88.4 polysome
772 GO0000011 9 -1.029 90.0 vacuole inheritance
773 GO0016298 13 -1.031 94.8 lipase activity
774 GO0006752 25 -1.032 102.6 group transfer coenzyme metabolism
775 GO0019239 7 -1.033 86.7 deaminase activity
776 GO0008250 7 -1.033 86.9 oligosaccharyl transferase complex
777 GO0004579 7 -1.033 86.9 dolichyl-diphosphooligosaccharide-protein glycosyltransferase activity
778 GO0004576 7 -1.033 86.9 oligosaccharyl transferase activity
779 GO0005763 20 -1.039 100.2 mitochondrial small ribosomal subunit
780 GO0000314 20 -1.039 100.2 organellar small ribosomal subunit
781 GO0017119 6 -1.040 84.3 Golgi transport complex
782 GO0000725 12 -1.051 93.2 recombinational repair
783 GO0000724 12 -1.051 93.2 double-strand break repair via homologous recombination
784 GO0006272 11 -1.051 91.3 leading strand elongation
785 GO0016462 7 -1.063 85.3 pyrophosphatase activity
786 GO0006888 41 -1.066 107.1 ER to Golgi transport
787 GO0042257 26 -1.066 101.3 ribosomal subunit assembly
788 GO0007067 77 -1.076 110.7 mitosis
789 GO0003678 15 -1.077 96.7 DNA helicase activity
790 GO0016896 21 -1.083 99.0 exoribonuclease activity, producing 5'-phosphomonoesters
791 GO0004532 21 -1.083 99.0 exoribonuclease activity
792 GO0009310 7 -1.093 84.0 amine catabolism
793 GO0000329 30 -1.102 102.8 vacuolar membrane (sensu Fungi)
794 GO0030435 53 -1.113 108.7 sporulation
795 GO0006259 242 -1.114 115.2 DNA metabolism
796 GO0008175 10 -1.125 90.7 tRNA methyltransferase activity
797 GO0000022 9 -1.128 87.3 mitotic spindle elongation
798 GO0006609 20 -1.140 98.0 mRNA-binding (hnRNP) protein-nucleus import
799 GO0042493 16 -1.143 95.9 response to drug
800 GO0008092 29 -1.144 103.0 cytoskeletal protein binding
801 GO0009593 32 -1.145 102.1 perception of chemical substance
802 GO0009582 32 -1.145 102.1 perception of abiotic stimulus
803 GO0009581 32 -1.145 102.1 perception of external stimulus
804 GO0007606 32 -1.145 102.1 chemosensory perception
805 GO0007600 32 -1.145 102.1 sensory perception
806 GO0008298 6 -1.147 80.3 mRNA localization, intracellular
807 GO0005686 7 -1.152 82.9 snRNP U2
808 GO0000092 7 -1.152 82.3 mitotic anaphase B
809 GO0009719 105 -1.153 111.9 response to endogenous stimulus
810 GO0042579 31 -1.157 102.8 microbody
811 GO0005777 31 -1.157 102.8 peroxisome
812 GO0046474 22 -1.160 98.4 glycerophospholipid biosynthesis
813 GO0016886 22 -1.160 98.3 ligase activity, forming phosphoric ester bonds
814 GO0016876 22 -1.160 98.3 ligase activity, forming aminoacyl-tRNA and related compounds
815 GO0016875 22 -1.160 98.3 ligase activity, forming carbon-oxygen bonds
816 GO0008452 22 -1.160 98.3 RNA ligase activity
817 GO0004812 22 -1.160 98.3 tRNA ligase activity
818 GO0019236 30 -1.162 101.3 response to pheromone
819 GO0005485 6 -1.174 79.0 v-SNARE activity
820 GO0016197 16 -1.186 94.1 endosome transport
821 GO0007032 16 -1.186 94.1 endosome organization and biogenesis
822 GO0016410 9 -1.193 85.1 N-acyltransferase activity
823 GO0008080 9 -1.193 85.1 N-acetyltransferase activity
824 GO0006974 102 -1.196 110.3 response to DNA damage stimulus
825 GO0008372 369 -1.201 115.7 cellular_component unknown
826 GO0015940 6 -1.201 78.8 pantothenate biosynthesis
827 GO0015939 6 -1.201 78.8 pantothenate metabolism
828 GO0006644 42 -1.202 104.5 phospholipid metabolism
829 GO0005875 12 -1.204 89.4 microtubule associated complex
830 GO0006402 32 -1.209 101.8 mRNA catabolism
831 GO0000001 9 -1.226 84.2 mitochondrion inheritance
832 GO0000090 26 -1.230 98.4 mitotic anaphase
833 GO0016251 39 -1.232 104.5 general RNA polymerase II transcription factor activity
834 GO0015931 46 -1.259 105.5 nucleobase, nucleoside, nucleotide and nucleic acid transport
835 GO0007152 14 -1.264 90.1 spore wall assembly (sensu Saccharomyces)
836 GO0008237 11 -1.266 85.7 metallopeptidase activity
837 GO0030437 47 -1.268 104.3 sporulation (sensu Fungi)
838 GO0016279 7 -1.271 78.1 protein-lysine N-methyltransferase activity
839 GO0016278 7 -1.271 78.1 lysine N-methyltransferase activity
840 GO0008054 7 -1.271 78.4 cyclin catabolism
841 GO0007151 42 -1.275 103.6 sporulation (sensu Saccharomyces)
842 GO0045324 8 -1.278 80.6 late endosome to vacuole transport
843 GO0004177 8 -1.278 80.1 aminopeptidase activity
844 GO0006273 12 -1.281 87.2 lagging strand elongation
845 GO0004519 30 -1.281 99.4 endonuclease activity
846 GO0005838 18 -1.293 93.6 proteasome regulatory particle (sensu Eukarya)
847 GO0016859 7 -1.301 77.9 cis-trans isomerase activity
848 GO0003755 7 -1.301 77.9 peptidyl-prolyl cis-trans isomerase activity
849 GO0000002 13 -1.305 87.4 mitochondrial genome maintenance
850 GO0030384 17 -1.307 94.2 phosphoinositide metabolism
851 GO0006271 23 -1.328 95.1 DNA strand elongation
852 GO0006401 37 -1.330 101.8 RNA catabolism
853 GO0005654 196 -1.332 112.5 nucleoplasm
854 GO0000300 6 -1.336 73.3 peripheral to membrane of membrane fraction
855 GO0008276 10 -1.337 84.7 protein methyltransferase activity
856 GO0030136 20 -1.342 94.7 clathrin-coated vesicle
857 GO0008173 15 -1.342 90.3 RNA methyltransferase activity
858 GO0016192 145 -1.351 111.7 vesicle-mediated transport
859 GO0007091 9 -1.357 80.3 mitotic metaphase/anaphase transition
860 GO0007049 318 -1.362 114.0 cell cycle
861 GO0006284 6 -1.363 72.3 base-excision repair
862 GO0000279 146 -1.366 111.2 M phase
863 GO0030471 24 -1.366 95.9 spindle pole body and microtubule cycle (sensu Fungi)
864 GO0007102 24 -1.366 95.9 spindle pole body and microtubule cycle (sensu Saccharomyces)
865 GO0006399 38 -1.383 101.6 tRNA metabolism
866 GO0000080 14 -1.386 87.0 G1 phase of mitotic cell cycle
867 GO0042244 15 -1.387 89.2 spore wall assembly
868 GO0030476 15 -1.387 89.2 spore wall assembly (sensu Fungi)
869 GO0003754 54 -1.387 104.9 chaperone activity
870 GO0045132 6 -1.390 71.5 meiotic chromosome segregation
871 GO0015631 9 -1.390 79.3 tubulin binding
872 GO0005635 51 -1.398 103.1 nuclear membrane
873 GO0005657 27 -1.398 96.7 replication fork
874 GO0006625 8 -1.404 76.6 protein-peroxisome targeting
875 GO0008170 16 -1.404 89.8 N-methyltransferase activity
876 GO0006913 62 -1.417 104.9 nucleocytoplasmic transport
877 GO0004521 15 -1.431 88.9 endoribonuclease activity
878 GO0006511 65 -1.433 104.1 ubiquitin-dependent protein catabolism
879 GO0016789 21 -1.433 92.9 carboxylic ester hydrolase activity
880 GO0006407 21 -1.433 92.9 rRNA-nucleus export
881 GO0000114 10 -1.443 81.8 G1-specific transcription in mitotic cell cycle
882 GO0007021 6 -1.444 69.5 tubulin folding
883 GO0007005 64 -1.458 104.6 mitochondrion organization and biogenesis
884 GO0005524 8 -1.466 74.5 ATP binding
885 GO0016741 54 -1.469 103.6 transferase activity, transferring one-carbon groups
886 GO0016944 10 -1.479 80.1 Pol II transcription elongation factor activity
887 GO0005856 126 -1.480 109.3 cytoskeleton
888 GO0016787 396 -1.481 114.6 hydrolase activity
889 GO0000226 55 -1.485 103.1 microtubule cytoskeleton organization and biogenesis
890 GO0008654 33 -1.489 98.8 phospholipid biosynthesis
891 GO0016684 6 -1.498 67.5 oxidoreductase activity, acting on peroxide as acceptor
892 GO0005876 11 -1.517 78.2 spindle microtubule
893 GO0005669 11 -1.517 78.7 transcription factor TFIID complex
894 GO0006400 22 -1.518 91.4 tRNA modification
895 GO0045005 15 -1.519 86.0 maintenance of fidelity during DNA dependent DNA replication
896 GO0006298 15 -1.519 86.0 mismatch repair
897 GO0004527 30 -1.521 95.8 exonuclease activity
898 GO0006611 31 -1.529 96.0 protein-nucleus export
899 GO0006312 19 -1.533 90.8 mitotic recombination
900 GO0006891 16 -1.535 86.9 intra-Golgi transport
901 GO0005794 76 -1.539 105.2 Golgi apparatus
902 GO0006281 84 -1.539 105.0 DNA repair
903 GO0009651 10 -1.550 78.9 salinity response
904 GO0000280 136 -1.552 109.3 nuclear division
905 GO0005680 8 -1.560 71.5 anaphase-promoting complex
906 GO0042255 29 -1.576 95.7 ribosome assembly
907 GO0000175 16 -1.578 85.4 3'-5' exoribonuclease activity
908 GO0006892 34 -1.580 95.8 post-Golgi transport
909 GO0046930 31 -1.591 95.5 pore complex
910 GO0006367 31 -1.591 96.0 transcription initiation from Pol II promoter
911 GO0005643 31 -1.591 95.5 nuclear pore
912 GO0009451 32 -1.592 95.5 RNA modification
913 GO0042727 7 -1.599 67.1 vitamin B2 and derivative biosynthesis
914 GO0042726 7 -1.599 67.1 vitamin B2 and derivative metabolism
915 GO0006384 7 -1.599 67.4 transcription initiation from Pol III promoter
916 GO0003709 7 -1.599 67.4 RNA polymerase III transcription factor activity
917 GO0004175 37 -1.606 97.1 endopeptidase activity
918 GO0000072 37 -1.606 97.6 M-phase specific microtubule process
919 GO0030163 94 -1.616 106.1 protein catabolism
920 GO0016455 12 -1.626 78.7 RNA polymerase II transcription mediator activity
921 GO0008023 12 -1.626 78.3 transcription elongation factor complex
922 GO0005778 12 -1.626 78.7 peroxisomal membrane
923 GO0003711 12 -1.626 78.3 transcriptional elongation regulator activity
924 GO0009231 6 -1.632 62.3 vitamin B2 biosynthesis
925 GO0006771 6 -1.632 62.3 vitamin B2 metabolism
926 GO0005819 47 -1.635 99.5 spindle
927 GO0005684 17 -1.642 87.9 major (U2-dependent) spliceosome
928 GO0006374 8 -1.655 68.6 nuclear mRNA splicing via U2-type spliceosome
929 GO0030554 9 -1.685 70.6 adenyl nucleotide binding
930 GO0006904 8 -1.686 67.4 nonselective vesicle docking
931 GO0030515 17 -1.690 86.5 snoRNA binding
932 GO0005739 404 -1.695 114.0 mitochondrion
933 GO0016788 131 -1.702 108.0 hydrolase activity, acting on ester bonds
934 GO0006360 121 -1.703 107.1 transcription from Pol I promoter
935 GO0015630 57 -1.717 101.9 microtubule cytoskeleton
936 GO0005828 8 -1.717 66.2 kinetochore microtubule
937 GO0007031 24 -1.725 88.9 peroxisome organization and biogenesis
938 GO0019941 66 -1.737 102.9 modification-dependent protein catabolism
939 GO0005486 6 -1.740 58.3 t-SNARE activity
940 GO0016853 29 -1.761 92.4 isomerase activity
941 GO0000754 6 -1.767 57.3 adaptation to pheromone during conjugation with cellular fusion
942 GO0005484 11 -1.768 71.4 SNAP receptor activity
943 GO0015036 8 -1.780 64.9 disulfide oxidoreductase activity
944 GO0006415 8 -1.780 64.1 translational termination
945 GO0006139 768 -1.789 115.4 nucleobase, nucleoside, nucleotide and nucleic acid metabolism
946 GO0005798 6 -1.794 56.3 Golgi vesicle
947 GO0006368 11 -1.804 70.3 RNA elongation from Pol II promoter
948 GO0042764 8 -1.811 63.9 prospore
949 GO0042763 8 -1.811 63.9 immature spore
950 GO0005628 8 -1.811 63.9 prospore membrane
951 GO0000177 9 -1.816 66.9 cytoplasmic exosome (RNase complex)
952 GO0006311 6 -1.821 55.7 meiotic gene conversion
953 GO0006605 138 -1.832 107.1 protein targeting
954 GO0008408 21 -1.834 84.8 3'-5' exonuclease activity
955 GO0008168 52 -1.860 98.3 methyltransferase activity
956 GO0008233 72 -1.865 101.5 peptidase activity
957 GO0007017 59 -1.868 98.6 microtubule-based process
958 GO0000119 14 -1.873 75.4 mediator complex
959 GO0006886 149 -1.875 107.7 intracellular protein transport
960 GO0005801 11 -1.875 68.6 Golgi cis-face
961 GO0006261 54 -1.878 98.0 DNA dependent DNA replication
962 GO0006896 13 -1.893 72.4 Golgi to vacuole transport
963 GO0015031 152 -1.899 107.8 protein transport
964 GO0030490 31 -1.900 90.3 processing of 20S pre-rRNA
965 GO0050658 40 -1.901 94.0 RNA transport
966 GO0050657 40 -1.901 94.0 nucleic acid transport
967 GO0006405 40 -1.901 94.0 RNA-nucleus export
968 GO0007051 27 -1.904 87.7 spindle assembly
969 GO0005839 14 -1.914 74.0 proteasome core complex (sensu Eukarya)
970 GO0004540 38 -1.928 93.8 ribonuclease activity
971 GO0016591 52 -1.941 97.8 DNA-directed RNA polymerase II, holoenzyme
972 GO0030008 8 -1.968 58.4 TRAPP
973 GO0007046 123 -1.975 106.0 ribosome biogenesis
974 GO0009059 240 -2.000 111.0 macromolecule biosynthesis
975 GO0030472 12 -2.009 68.4 mitotic spindle assembly (sensu Fungi)
976 GO0000071 12 -2.009 68.4 mitotic spindle assembly (sensu Saccharomyces)
977 GO0006508 85 -2.024 102.9 proteolysis and peptidolysis
978 GO0005478 17 -2.026 79.1 intracellular transporter activity
979 GO0006996 339 -2.037 111.2 organelle organization and biogenesis
980 GO0007006 9 -2.045 59.3 mitochondrial membrane organization and biogenesis
981 GO0006364 101 -2.048 102.6 rRNA processing
982 GO0016044 16 -2.057 74.2 membrane organization and biogenesis
983 GO0007007 6 -2.063 46.2 inner mitochondrial membrane organization and biogenesis
984 GO0009057 131 -2.085 104.9 macromolecule catabolism
985 GO0003729 61 -2.085 96.7 mRNA binding
986 GO0003723 132 -2.108 105.1 RNA binding
987 GO0007020 23 -2.128 80.9 microtubule nucleation
988 GO0048193 88 -2.133 100.7 Golgi vesicle transport
989 GO0006887 33 -2.144 88.8 exocytosis
990 GO0045045 125 -2.155 104.5 secretory pathway
991 GO0006906 18 -2.156 75.7 nonselective vesicle fusion
992 GO0006352 39 -2.161 91.5 transcription initiation
993 GO0000176 10 -2.186 60.4 nuclear exosome (RNase complex)
994 GO0005200 35 -2.189 88.3 structural constituent of cytoskeleton
995 GO0000502 35 -2.189 88.8 proteasome complex (sensu Eukarya)
996 GO0004518 56 -2.217 95.2 nuclease activity
997 GO0006403 47 -2.221 91.6 RNA localization
998 GO0016194 19 -2.228 76.4 nonselective vesicle exocytosis
999 GO0006406 36 -2.255 89.1 mRNA-nucleus export
1000 GO0007052 25 -2.255 80.1 mitotic spindle assembly
1001 GO0000178 11 -2.269 57.4 exosome (RNase complex)
1002 GO0006461 33 -2.275 86.7 protein complex assembly
1003 GO0006412 236 -2.280 108.9 protein biosynthesis
1004 GO0000228 80 -2.314 97.1 nuclear chromosome
1005 GO0007059 48 -2.323 92.3 chromosome segregation
1006 GO0008757 36 -2.325 88.9 S-adenosylmethionine-dependent methyltransferase activity
1007 GO0042254 138 -2.360 103.6 ribosome biogenesis and assembly
1008 GO0006623 41 -2.384 89.6 protein-vacuolar targeting
1009 GO0005768 31 -2.395 82.9 endosome
1010 GO0046489 15 -2.404 66.9 phosphoinositide biosynthesis
1011 GO0006506 13 -2.442 58.0 GPI anchor biosynthesis
1012 GO0006505 13 -2.442 58.0 GPI anchor metabolism
1013 GO0005634 1109 -2.443 115.0 nucleus
1014 GO0017076 18 -2.443 69.5 purine nucleotide binding
1015 GO0007131 19 -2.476 71.2 meiotic recombination
1016 GO0042158 19 -2.525 70.2 lipoprotein biosynthesis
1017 GO0042157 19 -2.525 70.2 lipoprotein metabolism
1018 GO0006497 19 -2.525 70.2 protein lipidation
1019 GO0003735 83 -2.533 97.5 structural constituent of ribosome
1020 GO0005762 24 -2.546 72.2 mitochondrial large ribosomal subunit
1021 GO0000315 24 -2.546 72.2 organellar large ribosomal subunit
1022 GO0046907 265 -2.554 106.1 intracellular transport
1023 GO0015934 45 -2.561 87.4 large ribosomal subunit
1024 GO0007033 77 -2.577 95.7 vacuole organization and biogenesis
1025 GO0030532 38 -2.609 83.1 small nuclear ribonucleoprotein complex
1026 GO0005761 45 -2.637 86.2 mitochondrial ribosome
1027 GO0000313 45 -2.637 86.2 organellar ribosome
1028 GO0000166 19 -2.674 67.2 nucleotide binding
1029 GO0005198 162 -2.684 102.6 structural molecule activity
1030 GO0000004 842 -2.699 113.5 biological_process unknown
1031 GO0007127 25 -2.700 73.0 meiosis I
1032 GO0005694 90 -2.759 96.0 chromosome
1033 GO0005554 1218 -2.792 113.7 molecular_function unknown
1034 GO0008380 65 -2.798 88.4 RNA splicing
1035 GO0019538 685 -2.799 111.8 protein metabolism
1036 GO0000067 149 -2.818 100.2 DNA replication and chromosome cycle
1037 GO0005681 40 -2.865 79.0 spliceosome complex
1038 GO0007128 23 -2.875 66.1 meiotic prophase I
1039 GO0007028 475 -2.888 109.2 cytoplasm organization and biogenesis
1040 GO0000778 24 -2.905 65.8 condensed nuclear chromosome kinetochore
1041 GO0000777 24 -2.905 65.8 condensed chromosome kinetochore
1042 GO0000776 30 -2.957 71.3 kinetochore
1043 GO0008248 31 -3.014 72.0 pre-mRNA splicing factor activity
1044 GO0030529 205 -3.025 102.0 ribonucleoprotein complex
1045 GO0000780 25 -3.145 64.0 condensed nuclear chromosome, pericentric region
1046 GO0000779 25 -3.145 64.0 condensed chromosome, pericentric region
1047 GO0006310 45 -3.165 79.3 DNA recombination
1048 GO0000775 33 -3.258 71.5 chromosome, pericentric region
1049 GO0000375 58 -3.312 83.0 RNA splicing, via transesterification reactions
1050 GO0000794 38 -3.563 69.3 condensed nuclear chromosome
1051 GO0000793 38 -3.563 69.3 condensed chromosome
1052 GO0006397 79 -3.641 85.6 mRNA processing
1053 GO0000398 55 -3.642 77.3 nuclear mRNA splicing, via spliceosome
1054 GO0000377 55 -3.642 77.3 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile
1055 GO0016070 253 -3.776 99.0 RNA metabolism
1056 GO0006396 220 -4.054 97.9 RNA processing